miRBase entry: cel-miR-243-3p

Accession	MIMAT0000299
Description	cel-miR-243-3p mature miRNA
Hairpins	cel-mir-243
Sequence	CGGUACGAUCGCGGCGGGAUAUC
Evidence	experimental cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.

Qualifier	GO term	Evidence	Reference	Annotation Extension
involved_in	GO:0050829 defense response to Gram-negative bacterium	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:32963007
involved_in	GO:1905911 positive regulation of dauer entry	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:32963007