Mature sequence cel-miR-265

Accession numberMIMAT0000321
IDcel-miR-265
Stem-Loop cel-mir-265
Sequence
ugagggaggaagggugguau
Get sequence
Deep sequencing8 reads, 4 experiments
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).