Accession | MIMAT0000409 |
Description | dme-miR-317-3p mature miRNA |
Hairpins | |
Sequence | UGAACACAGCUGGUGGUAUCCAGU |
Evidence |
experimental
cloned [1], 454 [2-3], Illumina [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 | |
involved_in | GO:0009617 response to bacterium |
ECO:0000270 expression pattern evidence used in manual assertion |
PMID:30708026 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 | |
involved_in | GO:0045751 negative regulation of Toll signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30708026 | |
involved_in | GO:0045824 negative regulation of innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30708026 | |
involved_in | GO:0061060 negative regulation of peptidoglycan recognition protein signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 |