Mature dme-miR-317-3p
| Accession | MIMAT0000409 |
| Description | dme-miR-317-3p mature miRNA |
| Hairpins | |
| Sequence | UGAACACAGCUGGUGGUAUCCAGU |
| Evidence |
experimental
cloned [1], 454 [2-3], Illumina [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 | |
| involved_in | GO:0009617 response to bacterium |
ECO:0000270 expression pattern evidence used in manual assertion |
PMID:30708026 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30708026 | |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 | |
| involved_in | GO:0045751 negative regulation of Toll signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30708026 | |
| involved_in | GO:0045824 negative regulation of innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30708026 | |
| involved_in | GO:0061060 negative regulation of peptidoglycan recognition protein signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36155909 |
