Mature sequence cbr-miR-124a

Accession numberMIMAT0000494
IDcbr-miR-124a
Previous IDscbr-miR-124
Stem-Loop cbr-mir-124a
Sequence
uaaggcacgcggugaaugcca
Get sequence
Deep sequencing reads, experiments

References