Mature sequence osa-miR156i

Accession numberMIMAT0000626
IDosa-miR156i
Stem-Loop osa-MIR156i
Sequence
ugacagaagagagugagcac
Get sequence
Deep sequencing560064 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).