Mature sequence osa-miR162a

Accession numberMIMAT0000632
IDosa-miR162a
Stem-Loop osa-MIR162a
Sequence
ucgauaaaccucugcauccag
Get sequence
Deep sequencing667 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).