Mature hsa-miR-302b-3p

• Accession: MIMAT0000715
• Description: hsa-miR-302b-3p mature miRNA
• Hairpins:
  • hsa-mir-302b
• Sequence: UAAGUGCUUCCAUGUUUUAGUAG
• Evidence: experimental ; cloned [1-2], Northern [1]

QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.

Qualifier	GO term	Evidence	Reference	Annotation Extension
enables	GO:1903231 mRNA base-pairing translational repressor activity	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:21490602	has_input UniProtKB:P37173
involved_in	GO:0010719 negative regulation of epithelial to mesenchymal transition	ECO:0000316 genetic interaction evidence used in manual assertion	PMID:21490602
involved_in	GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:21490602	has_input UniProtKB:P37173
involved_in	GO:0035195 miRNA-mediated post-transcriptional gene silencing	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:21490602	has_input UniProtKB:P37173
involved_in	GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:21490602	has_input UniProtKB:P01137
involved_in	GO:2000736 regulation of stem cell differentiation	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:21490602