MIR302B is a member of the miR302 cluster of microRNAs, which plays a significant role in promoting human somatic cell reprogramming and is highly expressed in embryonic stem cells [PMC4164941]'>PMC4164941], [PMC6722449]. The expression of MIR302B, along with miR302c, is upregulated in human corneal endothelial cells (HCECs) following the knockdown by p120 siRNA or p120-Kaiso siRNAs [PMC4164941]. This upregulation is associated with the activation of canonical BMP signaling and correlates with nuclear staining of pluripotency markers such as Oct4, Sox2, and Nanog [PMC4164941]. However, MIR302B expression can be inhibited by Noggin and CT-04 as well as by siRNA targeting ROCK1 and ROCK2 [PMC4164941]. In addition to its role in pluripotency, MIR302B has been implicated in various biological processes such as oxidative stress response, inflammation regulation, cell migration and proliferation inhibition in endothelial cells derived from induced pluripotent stem cells (iPSC-ECs) from end-stage renal disease patients [PMC8685359], [PMC5858164]. Furthermore, MIR302B has been shown to target EGFR at the translational level but not at the transcription level in certain cell lines [PMC3850949], indicating its potential involvement in post-transcriptional gene regulation.
gcucc a UU U guga
cuuc ACU AACAUGGAAGUGCUU Cu c
|||| ||| ||||||||||||||| || u
gagG UGA UUGUACCUUCGUGAA ga u
----u A UU U aaau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000714 |
| Description | Homo sapiens hsa-miR-302b-5p mature miRNA |
| Sequence | 11 - ACUUUAACAUGGAAGUGCUUUC - 32 |
| Evidence |
experimental
cloned [1-2], Northern [1] |
| Accession | MIMAT0000715 |
| Description | Homo sapiens hsa-miR-302b-3p mature miRNA |
| Sequence | 47 - UAAGUGCUUCCAUGUUUUAGUAG - 69 |
| Evidence |
experimental
cloned [1-2], Northern [1] |
| Database links |
|
| Predicted targets |
|
|