miRBase entry: hsa-mir-302b

Stem-loop hsa-mir-302b


Accession
MI0000772
Symbol
HGNC: MIR302B
Description
Homo sapiens hsa-mir-302b precursor miRNA
Gene family
MIPF0000071; mir-302

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR302B is a member of the miR302 cluster, which is known to play a role in promoting human somatic cell reprogramming [PMC4164941]. In a mouse endothelial cell model, the expression of MIR302B and miR302c was down-regulated by ROCK1 siRNA and ROCK2 siRNA [PMC4164941]. Knockdown of p120 or p120-Kaiso siRNAs in human corneal endothelial cells (HCECs) resulted in increased expression of MIR302B and miR302c [PMC4164941]. Noggin blocked the overexpression of MIR302B and miR302c, as well as the nuclear translocation of ESC markers and positive expression of neural crest markers [PMC4164941]. In HCEC monolayers, reprogramming by canonical BMP signaling was associated with nuclear staining of Oct4, Sox2, and Nanog, as well as up-regulation of MIR302B [PMC4164941].

MIR302B is also upregulated in ESRD-hiPSC-ECs (endothelial cells derived from induced pluripotent stem cells) associated with oxidative stress and inflammation [PMC8685359]. It is highly expressed in human oral fibroblast-induced pluripotent stem cells (hOF-iPSCs) along with other pluripotent markers such as NANOG and OCT4 [PMC4538314].

MIR302B has been shown to induce apoptosis in tumor/cancer cell lines when overexpressed along with other members of the miR-302 cluster such as MIR302A, MIR302C, and MIR302D [PMC4400607]. It has also been implicated in regulating EGFR expression at the translational level in SMMC-7721 cells [PMC3850949].

Overall, MIR302B is a member of the miR302 cluster that plays a role in somatic cell reprogramming, pluripotency, and apoptosis in cancer cells [PMC4164941][PMC8685359][PMC4538314][PMC4400607][PMC3850949[PMC8685359][PMC4538314][PMC4400607][PMC3850949].

Literature search
193 open access papers mention hsa-mir-302b
(1248 sentences)

Sequence

587 reads, 12 reads per million, 16 experiments
gcucccuucaACUUUAACAUGGAAGUGCUUUCugugacuuuaaaagUAAGUGCUUCCAUGUUUUAGUAGgagu
.....((((.(((..(((((((((((((((.((...........)).)))))))))))))))..))).)))).

Structure
gcucc    a   UU               U  guga 
     cuuc ACU  AACAUGGAAGUGCUU Cu    c
     |||| |||  ||||||||||||||| ||    u
     gagG UGA  UUGUACCUUCGUGAA ga    u
----u    A   UU               U  aaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 112648485-112648557 [-]
Clustered miRNAs
4 other miRNAs are < 10 kb from hsa-mir-302b
Name Accession Chromosome Start End Strand Confidence



Biological pathways
hsa-mir-302b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-302b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-302b-5p

Accession MIMAT0000714
Description Homo sapiens hsa-miR-302b-5p mature miRNA
Sequence 11 - ACUUUAACAUGGAAGUGCUUUC - 32
Evidence experimental
cloned [1-2], Northern [1]

Mature hsa-miR-302b-3p

Accession MIMAT0000715
Description Homo sapiens hsa-miR-302b-3p mature miRNA
Sequence 47 - UAAGUGCUUCCAUGUUUUAGUAG - 69
Evidence experimental
cloned [1-2], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414