Accession | MIMAT0000715 |
Description | hsa-miR-302b-3p mature miRNA |
Hairpins | |
Sequence | UAAGUGCUUCCAUGUUUUAGUAG |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21490602 | has_input UniProtKB:P37173 |
involved_in | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21490602 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21490602 | has_input UniProtKB:P37173 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21490602 | has_input UniProtKB:P37173 |
involved_in | GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21490602 | has_input UniProtKB:P01137 |
involved_in | GO:2000736 regulation of stem cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21490602 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|