Mature sequence osa-miR395a

• Accession number: MIMAT0000973
• ID: osa-miR395a
• Previous IDs: osa-miR395c
• Stem-Loop: osa-MIR395a
• Sequence: gugaagugcuugggggaacuc
• Deep sequencing: 24 reads, 2 experiments

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).
3. PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).