Mature sequence osa-miR398a

Accession numberMIMAT0000982
IDosa-miR398a
Stem-Loop osa-MIR398a
Sequence
uguguucucaggucaccccuu
Get sequence
Deep sequencing7 reads, 2 experiments

References

1