Mature sequence osa-miR399d

Accession numberMIMAT0000987
IDosa-miR399d
Stem-Loop osa-MIR399d
Sequence
ugccaaaggagaguugcccug
Get sequence
Deep sequencing7 reads, 2 experiments
Database links
QuickGO function

References

1