Mature sequence osa-miR159a.1

Accession numberMIMAT0001022
IDosa-miR159a.1
Previous IDsosa-miR159a
Stem-Loop osa-MIR159a
Sequence
uuuggauugaagggagcucug
Get sequence
Deep sequencing2239 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).