Mature sequence osa-miR319b

Accession numberMIMAT0001029
IDosa-miR319b
Stem-Loop osa-MIR319b
Sequence
uuggacugaagggugcuccc
Get sequence
Deep sequencing112 reads, 2 experiments
Database links
QuickGO function

References

1