Mature sequence osa-miR168a-5p

Accession numberMIMAT0001045
IDosa-miR168a-5p
Previous IDsosa-miR168a
Stem-Loop osa-MIR168a
Sequence
ucgcuuggugcagaucgggac
Get sequence
Deep sequencing432603 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).