Mature sequence osa-miR169o

Accession numberMIMAT0001060
IDosa-miR169o
Stem-Loop osa-MIR169o
Sequence
uagccaagaaugacuugccua
Get sequence
Deep sequencing1343 reads, 2 experiments
Database links
QuickGO function

References

1