Mature sequence osa-miR172a

Accession numberMIMAT0001069
IDosa-miR172a
Stem-Loop osa-MIR172a
Sequence
agaaucuugaugaugcugcau
Get sequence
Deep sequencing5292 reads, 2 experiments
Database links
QuickGO function

References

1