Mature sequence osa-miR172b

Accession numberMIMAT0001070
IDosa-miR172b
Stem-Loop osa-MIR172b
Sequence
ggaaucuugaugaugcugcau
Get sequence
Deep sequencing5074 reads, 2 experiments
Database links
QuickGO function

References

1