Mature sequence osa-miR172c

Accession numberMIMAT0001071
IDosa-miR172c
Stem-Loop osa-MIR172c
Sequence
ugaaucuugaugaugcugcac
Get sequence
Deep sequencing5068 reads, 2 experiments
Database links
QuickGO function

References

1