Mature sequence osa-miR167j

Accession numberMIMAT0001086
IDosa-miR167j
Stem-Loop osa-MIR167j
Sequence
ugaagcugccagcaugaucug
Get sequence
Deep sequencing86998 reads, 2 experiments
Database links
QuickGO function

References

1