Mature sequence gga-miR-124b

Accession numberMIMAT0001174
IDgga-miR-124b
Stem-Loop gga-mir-124b
Sequence
uuaaggcacgcagugaaugcca
Get sequence
Deep sequencing148401 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).