Mature sequence dps-let-7

Accession numberMIMAT0001198
IDdps-let-7
Stem-Loop dps-let-7
Sequence
ugagguaguagguuguauagu
Get sequence
Deep sequencing reads, experiments

References