Mature sequence dps-miR-125

Accession numberMIMAT0001230
IDdps-miR-125
Stem-Loop dps-mir-125
Sequence
ucccugagacccuaacuuguga
Get sequence
Deep sequencing reads, experiments

References