Mature sequence zma-miR169a-5p

Accession numberMIMAT0001368
IDzma-miR169a-5p
Previous IDszma-miR169a
Stem-Loop zma-MIR169a
Sequence
cagccaaggaugacuugccga
Get sequence
Deep sequencing1140 reads, 25 experiments
Database links
QuickGO function

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).