Mature sequence mghv-miR-M1-2-3p

Accession numberMIMAT0001565
IDmghv-miR-M1-2-3p
Previous IDsmhv-miR-M1-2;mghv-miR-M1-2
Stem-Loop mghv-mir-M1-2
Sequence
cagacccccucucccccucuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).