Mature sequence hcmv-miR-US5-2-3p

• Accession number: MIMAT0001580
• ID: hcmv-miR-US5-2-3p
• Previous IDs: hcv-miR-US5-2
• Stem-Loop: hcmv-mir-US5-2
• Sequence: uaugauaggugugacgaugucu
• Deep sequencing: reads, experiments

References

1. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:22013051 "High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection" Stark TJ, Arnold JD, Spector DH, Yeo GW J Virol. 86:226-235(2012).