Mature sequence hcmv-miR-US33-5p

Accession numberMIMAT0001584
IDhcmv-miR-US33-5p
Previous IDshcv-miR-US33-1;hcmv-miR-US33-1;hcmv-miR-US33
Stem-Loop hcmv-mir-US33
Sequence
gauugugcccggaccgugggcg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
4
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).