Mature sequence zma-miR156k-5p

Accession numberMIMAT0001749
IDzma-miR156k-5p
Previous IDszma-miR156k
Stem-Loop zma-MIR156k
Sequence
ugacagaagagagcgagcac
Get sequence
Deep sequencing207570 reads, 196 experiments
Database links
QuickGO function

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).