Mature sequence dre-miR-132-3p

Accession numberMIMAT0001829
IDdre-miR-132-3p
Previous IDsdre-miR-132
Stem-Loop dre-mir-132-1 dre-mir-132-2 dre-mir-132-3
Sequence
uaacagucuacagccauggucg
Get sequence
Deep sequencing381 reads, 9 experiments
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).