Mature sequence dre-miR-155

Accession numberMIMAT0001851
IDdre-miR-155
Stem-Loop dre-mir-155
Sequence
uuaaugcuaaucgugauagggg
Get sequence
Deep sequencing1958 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).