Mature sequence dre-miR-200a-3p

Accession numberMIMAT0001861
IDdre-miR-200a-3p
Previous IDsdre-miR-200a
Stem-Loop dre-mir-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Deep sequencing73002 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).