Mature sequence dre-miR-216b

Accession numberMIMAT0001867
IDdre-miR-216b
Stem-Loop dre-mir-216b
Sequence
uaaucucugcaggcaacuguga
Get sequence
Deep sequencing206 reads, 11 experiments
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).