Mature sequence ptc-miR169ac

Accession numberMIMAT0001954
IDptc-miR169ac
Stem-Loop ptc-MIR169ac
Sequence
uagccaaggacgacuugccca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).