Mature sequence gga-miR-202-3p

Accession numberMIMAT0003355
IDgga-miR-202-3p
Previous IDsgga-miR-202
Stem-Loop gga-mir-202
Sequence
agaggcauagagcaugggaaaa
Get sequence
Deep sequencing282 reads, 1 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.