Mature sequence gga-miR-302c-5p

Accession numberMIMAT0003358
IDgga-miR-302c-5p
Previous IDsgga-miR-302c*
Stem-Loop gga-mir-302c
Sequence
uuuaacauggagguaccugcug
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References