Mature sequence gga-miR-302c-3p

Accession numberMIMAT0003359
IDgga-miR-302c-3p
Previous IDsgga-miR-302c
Stem-Loop gga-mir-302c
Sequence
uaagugcuuccauguuucagugg
Get sequence
Deep sequencing7 reads, 2 experiments
Predicted targets

References