Mature sequence gga-miR-302d

Accession numberMIMAT0003360
IDgga-miR-302d
Stem-Loop gga-mir-302d
Sequence
uaagugcuuccauguuuuaguug
Get sequence
Deep sequencing7 reads, 2 experiments
Predicted targets

References