Mature sequence gga-miR-375

Accession numberMIMAT0003362
IDgga-miR-375
Stem-Loop gga-mir-375
Sequence
uuuguucguucggcucgcguua
Get sequence
Deep sequencing1803 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References