Mature sequence mmu-miR-721

Accession numberMIMAT0003515
IDmmu-miR-721
Stem-Loop mmu-mir-721
Sequence
cagugcaauuaaaagggggaa
Get sequence
Deep sequencing14 reads, 9 experiments
Predicted targets

References

1
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).