Mature sequence bta-miR-18b

• Accession number: MIMAT0003517
• ID: bta-miR-18b
• Stem-Loop: bta-mir-18b
• Sequence: uaaggugcaucuagugcaguua
• Deep sequencing: 3877 reads, 67 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-18b

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).