Mature sequence bta-miR-20a

Accession numberMIMAT0003527
IDbta-miR-20a
Stem-Loop bta-mir-20a
Sequence
uaaagugcuuauagugcagguag
Get sequence
Deep sequencing8408 reads, 73 experiments
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).