Bta-mir-20a is a microRNA that has been identified as a master regulator in various studies [PMC9445238]. It has been found to be downregulated in some cases [PMC9445238], while in other studies it has been identified as one of the highly expressed and constant miRNAs [PMC6691986]. Bta-mir-20a has also been validated as a regulator of PTEN (phosphatase and tensin homolog) in bovine granulosa cells [PMC5602670]. In follicular cells (FCs) derived from follicles with poor oocyte quality, the levels of bta-mir-20a were found to be lower, suggesting reduced activity of the PI3K-Akt signaling pathway [PMC5602670]. Bta-mir-20a, along with other miRNAs such as bta-miR-494, were significantly higher in FCs derived from follicles where oocyte cleavage occurred [PMC5602670]. In another study, bta-mir-20a was found to be differentially expressed in high and low motility fractions of bull spermatozoa [PMC9113469]. Furthermore, bta-mir-20a was among the miRNAs that were differentially expressed during early pregnancy in cattle when analyzed from milk and plasma samples [PMC6418173]. It is worth noting that bta-mir-20a did not follow the same expression trend as other members of its cluster or polycistronic miRNAs such as bta-miR-25 and bta-miR-92 [PMC5325256]. Overall, these studies highlight the importance of bta-mir-20a in various biological processes and its potential role as a regulator.
c -A G uguu guag acU AAGUGCUUAUAGUGCAG UAG u |||| ||| ||||||||||||||||| ||| a cguc uga uucacgaguauuacguc auc g a aa - uauu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003527 |
Description | Bos taurus bta-miR-20a mature miRNA |
Sequence | 8 - UAAAGUGCUUAUAGUGCAGGUAG - 30 |
Evidence |
experimental
cloned [1] |
|