miRBase entry: bta-mir-20a

Stem-loop bta-mir-20a


Accession
MI0004741
Description
Bos taurus bta-mir-20a precursor miRNA
Gene family
MIPF0000001; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-20a is a microRNA that has been identified as a master regulator in various studies [PMC9445238]. It has been found to be downregulated in some cases [PMC9445238], while in other studies it has been identified as one of the highly expressed and constant miRNAs [PMC6691986]. Bta-mir-20a has also been validated as a regulator of PTEN (phosphatase and tensin homolog) in bovine granulosa cells [PMC5602670]. In follicular cells (FCs) derived from follicles with poor oocyte quality, the levels of bta-mir-20a were found to be lower, suggesting reduced activity of the PI3K-Akt signaling pathway [PMC5602670]. Bta-mir-20a, along with other miRNAs such as bta-miR-494, were significantly higher in FCs derived from follicles where oocyte cleavage occurred [PMC5602670]. In another study, bta-mir-20a was found to be differentially expressed in high and low motility fractions of bull spermatozoa [PMC9113469]. Furthermore, bta-mir-20a was among the miRNAs that were differentially expressed during early pregnancy in cattle when analyzed from milk and plasma samples [PMC6418173]. It is worth noting that bta-mir-20a did not follow the same expression trend as other members of its cluster or polycistronic miRNAs such as bta-miR-25 and bta-miR-92 [PMC5325256]. Overall, these studies highlight the importance of bta-mir-20a in various biological processes and its potential role as a regulator.

Literature search
22 open access papers mention bta-mir-20a
(93 sentences)

Sequence

6484 reads, 99 reads per million, 70 experiments
guagcacUAAAGUGCUUAUAGUGCAGGUAGuguuuaguuaucuacugcauuaugagcacuuaaaguacugc
((((.(((.(((((((((((((((((.(((...........))))))))))))))))))))..))).))))

Structure
    c   -A                 G   uguu 
guag acU  AAGUGCUUAUAGUGCAG UAG    u
|||| |||  ||||||||||||||||| |||    a
cguc uga  uucacgaguauuacguc auc    g
    a   aa                 -   uauu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr12: 66421687-66421757 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from bta-mir-20a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-20a

Accession MIMAT0003527
Description Bos taurus bta-miR-20a mature miRNA
Sequence 8 - UAAAGUGCUUAUAGUGCAGGUAG - 30
Evidence experimental
cloned [1]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43