bta-mir-20a is a microRNA (miRNA) that has been identified as a master regulator and is upregulated in certain bovine conditions [PMC9445238]. It has been characterized as differentially expressed (DE) with a fold change (FC) less than 2.0 [PMC5736867]. Due to its stable expression, bta-mir-20a is used as an endogenous control in quantitative real-time PCR (qRT-PCR) assays, alongside other miRNAs like bta-miR-181a, bta-miR-30b-5p, and bta-miR-378 [PMC6691986]. It has been validated as a regulator of the PTEN gene in bovine granulosa cells and is associated with the PI3K-Akt signaling pathway's activity in follicular cells (FCs), influencing oocyte quality [PMC5602670]. The expression of bta-mir-20a was found to be significantly higher in FCs from follicles that led to oocyte cleavage, indicating its potential role in oocyte developmental potential [PMC5602670]. Despite its stable expression across different fertility conditions, it was differentially expressed in milk and plasma during early pregnancy in cattle [PMC6418173], but it did not follow the same expression trend as other miRNAs within its cluster during early pregnancy stages [PMC5325256].
c -A G uguu guag acU AAGUGCUUAUAGUGCAG UAG u |||| ||| ||||||||||||||||| ||| a cguc uga uucacgaguauuacguc auc g a aa - uauu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003527 |
Description | Bos taurus bta-miR-20a mature miRNA |
Sequence | 8 - UAAAGUGCUUAUAGUGCAGGUAG - 30 |
Evidence |
experimental
cloned [1] |
|