Mature sequence gga-miR-146b-3p

Accession numberMIMAT0003724
IDgga-miR-146b-3p
Previous IDsgga-miR-146b*
Stem-Loop gga-mir-146b
Sequence
cccuauggauucaguucugc
Get sequence
Deep sequencing983 reads, 5 experiments
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).