Mature sequence dre-miR-737-3p

Accession numberMIMAT0003768
IDdre-miR-737-3p
Previous IDsdre-miR-737
Stem-Loop dre-mir-737
Sequence
aaucaaaaccuaaagaaaaua
Get sequence
Deep sequencing70 reads, 2 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).