Mature sequence gga-miR-451

Accession numberMIMAT0003775
IDgga-miR-451
Stem-Loop gga-mir-451
Sequence
aaaccguuaccauuacugaguuu
Get sequence
Deep sequencing385429 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).