Mature sequence osa-miR815a

Accession numberMIMAT0004058
IDosa-miR815a
Stem-Loop osa-MIR815a
Sequence
aaggggauugaggagauuggg
Get sequence
Deep sequencing1898 reads, 2 experiments
Database links
QuickGO function

References

1