Mature sequence osa-miR815b

Accession numberMIMAT0004059
IDosa-miR815b
Stem-Loop osa-MIR815b
Sequence
aaggggauugaggagauuggg
Get sequence
Deep sequencing3558 reads, 2 experiments
Database links
QuickGO function

References

1