Mature sequence osa-miR818a

Accession numberMIMAT0004063
IDosa-miR818a
Stem-Loop osa-MIR818a
Sequence
aaucccuuauauuaugggacgg
Get sequence
Deep sequencing2122 reads, 2 experiments
Database links
QuickGO function

References

1