Mature sequence osa-miR818d

Accession numberMIMAT0004066
IDosa-miR818d
Stem-Loop osa-MIR818d
Sequence
aaucccuuauauuaugggacgg
Get sequence
Deep sequencing2731 reads, 2 experiments
Database links
QuickGO function

References

1