Mature sequence osa-miR818e

Accession numberMIMAT0004067
IDosa-miR818e
Stem-Loop osa-MIR818e
Sequence
aaucccuuauauuaugggacgg
Get sequence
Deep sequencing1801 reads, 2 experiments
Database links
QuickGO function

References

1